Cart 3 Product Products 452,77 € (empty)
-
1 x Goat...225,00 € -
-
1 x PON3-parao...121,50 €
No products
To be determined Shipping
452,77 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 452,77 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 452,77 €
Data sheet of KRTAP13-1-keratin associated protein 13-1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP13-1-keratin associated protein 13-1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113536 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP13-1 |
| Origin species: | Human |
| Product name: | KRTAP13-1-keratin associated protein 13-1 Gene |
| Size: | 2ug |
| Accessions: | BC113536 |
| Gene id: | 140258 |
| Gene description: | keratin associated protein 13-1 |
| Synonyms: | KAP13.1; KRTAP13.1; keratin-associated protein 13-1; high sulfur keratin associated protein 13.1; keratin associated protein 13-1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggcatgcaaactcagaatcttctcagtgtaactcagctgaactcacatctcccatcaacatgtcctacaactgctgctctggaaacttctcctcccgctcctgtggtggctacctgcactacccagcctcctcctgtggcttttcctaccccagcaaccaggtctacagcactgacctctgctctcccagcacgtgccagctgggttcctctctctataggggctgtcagcagacctgctgggagcccaccagctgccagacatcctatgtggagtccagcccctgccagacctcctgctaccgtcccagaacctccttgctctgcagtccctgccagacaacttactctgggtctctaggctttggatccagcagctgccgctccctgggctatggatcgaggagctgctactcagtgggctgtgggtccagtggcttcagatccctgggttatggaggctgtggcttcccttccctgggctatggcgttggattctgccgcccaacctacttggcttctaggagctgccagtcttcttgctacagaccaacttgtggatcaggcttctactattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 10-3 - lipoma HMGIC fusion partner-like 4 - RAB40A, member RAS oncogene family - RAB11B, member RAS oncogene family |