Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MSRB2-methionine sulfoxide reductase B2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MSRB2-methionine sulfoxide reductase B2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117471 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MSRB2 |
| Origin species: | Human |
| Product name: | MSRB2-methionine sulfoxide reductase B2 Gene |
| Size: | 2ug |
| Accessions: | BC117471 |
| Gene id: | 22921 |
| Gene description: | methionine sulfoxide reductase B2 |
| Synonyms: | CBS-1; CBS1; CGI-131; MSRB; PILB; methionine-R-sulfoxide reductase B2, mitochondrial; pilin-like transcription factor; methionine sulfoxide reductase B2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcggctcctctggttgctccggggcctgaccctcggaactgcgcctcggcgggcggtgcggggccaagcgggcggcggcgggcccggcaccgggccgggactgggggaggcagggtctcttgcaacgtgtgagctgcctcttgccaagagtgagtggcaaaagaaactaaccccggagcagttctacgtcacaagagaaaagggaacggaaccgcctttcagtgggatctacctgaataacaaggaagcaggaatgtatcattgcgtgtgctgcgacagtccactcttcagttctgagaaaaagtactgctctggcactgggtggccttcgttttccgaggctcatggtacgtctggctctgatgaaagccacacagggatcctgagacgtctggatacctcgttaggatcagctcgcacagaggttgtctgcaagcagtgtgaagctcatctaggtcacgtgtttcctgatggacctgggcccaatggtcagaggttttgcatcaacagtgtggctttgaagttcaaaccaaggaaacactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - shisa homolog 4 (Xenopus laevis) - coiled-coil domain containing 84 - shisa homolog 2 (Xenopus laevis) - outer dense fiber of sperm tails 3 |