CRYGN-crystallin, gamma N Gene

View larger

CRYGN-crystallin, gamma N Gene

Reference: PTXBC100880

Condition: New product

Print

Data sheet of CRYGN-crystallin, gamma N Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about CRYGN-crystallin, gamma N Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC100880
Product type:	DNA & cDNA
Ncbi symbol:	CRYGN
Origin species:	Human
Product name:	CRYGN-crystallin, gamma N Gene
Size:	2ug
Accessions:	BC100880
Gene id:	155051
Gene description:	crystallin, gamma N
Synonyms:	gamma-crystallin N; gamma-N-crystallin; gammaN-crystallin; crystallin gamma N
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggcgcagcgctcggggaagatcactctctatgaaggcaagcacttcacagggcagaagctggaggtcttcggggactgtgacaacttccaggaccggggctttatgaaccgagtgaactccatccacgtggagagcggagcctgggtctgcttcaatcaccccgacttccggggccagcagttcatcttggagcacggcgactaccccgacttcttccgctggaacagccacagtgaccacatgggctcctgtcggcctgtaggaatgcacggagaacatttccgcctagaaatcttcgagggttgcaacttcacgggccagtgcctggagttcctggaggacagccccttcctccagagcaggggctgggtcaagaactgtgtgaacaccatcaaggtgtacggggacggagcagcatggagccctagaagcttcggagctgaggacttccagctgagcagctctcttcaatcagatcaaggaccggaagaggccaccacaaaaccagcaacaacccagccacctttcctgactgcaaacctctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- FLJ41423 protein - crystallin, gamma D - elastase 2B - H6 family homeobox 2

Reviews

Be the first to write your review !

Buy CRYGN-crystallin, gamma N Gene now