Cart 38 Product Products 9 647,30 € (empty)
-
1 x RCAN2-regu...113,40 € -
1 x MED28-medi...113,40 € -
1 x ZBTB8OS-zi...113,40 € -
-
-
1 x CLTA-clath...113,40 € -
1 x TBCB-tubul...113,40 € -
1 x FPR3-formy...121,50 € -
1 x PERK...259,07 € -
1 x FN3K-fruct...121,50 € -
1 x Periphilin...259,07 € -
-
-
1 x GOSR2-golg...113,40 € -
-
-
1 x NUP43-nucl...121,50 € -
-
-
1 x ALG14-aspa...113,40 € -
1 x CCDC74A-co...121,50 € -
1 x NTSR2-neur...121,50 € -
-
1 x CKB-creati...121,50 € -
1 x RAB20-RAB2...113,40 € -
-
-
1 x SCOC-short...113,40 € -
1 x CDX2-cauda...121,50 € -
-
-
1 x Donkey...4 799,76 € -
1 x RAB30-RAB3...113,40 € -
1 x CINP-cycli...113,40 € -
-
-
-
1 x CCDC26-coi...113,40 €
No products
To be determined Shipping
9 647,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 38 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 9 647,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 9 647,30 €
Data sheet of KRTAP13-3-keratin associated protein 13-3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP13-3-keratin associated protein 13-3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103965 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP13-3 |
| Origin species: | Human |
| Product name: | KRTAP13-3-keratin associated protein 13-3 Gene |
| Size: | 2ug |
| Accessions: | BC103965 |
| Gene id: | 337960 |
| Gene description: | keratin associated protein 13-3 |
| Synonyms: | KAP13.3; keratin-associated protein 13-3; keratin associated protein 13-3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctacaactgttgctctagaaacttctcctcctgctcccacgggggttacttgcactacccaggctcctcctgtggctcttcctaccccagcaacctggtctacagcactgacctctgctctcccagcacctgccagctgggttcctctctctataggggctgtcaggagacctgctggaggcccaacagctgtcagacattgtgtgttgagtccagcccctgccacacctcctgctactaccccaggactcacatgctctgcaattcttgcctgactatgcatgttgggtctcggggttttggatccaatagctgctgctccctgagctgtggatccaggagctgctcctcactgggctgtggatccaatggcttcagatatctgaattatagaatccatacctccccttcccagagttatagatccagattctgccatccaatctattttccacctagaaggtggttccattcatcttgttatcagccattctgtagatctggtttctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lipoma HMGIC fusion partner-like 1 - keratin associated protein 13-1 - keratin associated protein 10-3 - lipoma HMGIC fusion partner-like 4 |