PTXBC098262
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC098262 |
Product type: | DNA & cDNA |
Ncbi symbol: | OBSCN |
Origin species: | Human |
Product name: | OBSCN-obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF Gene |
Size: | 2ug |
Accessions: | BC098262 |
Gene id: | 84033 |
Gene description: | obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF |
Synonyms: | ARHGEF30; UNC89; obscurin; obscurin, myosin light chain kinase; obscurin-MLCK; obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcactgcacagtggatggagaaactgtgattcttgtgctgggaggtggtggggcttctcccagctacatggccagtgccaagcttgggaaggttctgtttctcctactttctcgtctaggccctcctaccctagggtggtcttcctgacctgggcagtatctttgacctcgtgtgtccctccttgtccatccccagagcccaaggtggtgtttgccaaggagcagccagcacacagggaggtgcaggctgaggcgggggccagtgccacgctgagctgcgaggtggcccaggcccagacagaggtgacgtggtacaaggatgggaagaagctgagttccagctcgaaagtgcgcgtggaggccgtgggctgcacacggaggctggtggtgcagcaggcgggccaggcagaggccggggagtacagctgcgaggcagggggtcagcagctctccttccgcctgcaggtggcaggtcagtgctttggggatgctgagtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 11 - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 - protein phosphatase 2C, magnesium-dependent, catalytic subunit - ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) |