Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PRDX5-peroxiredoxin 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRDX5-peroxiredoxin 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113723 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRDX5 |
| Origin species: | Human |
| Product name: | PRDX5-peroxiredoxin 5 Gene |
| Size: | 2ug |
| Accessions: | BC113723 |
| Gene id: | 25824 |
| Gene description: | peroxiredoxin 5 |
| Synonyms: | ACR1; AOEB166; B166; HEL-S-55; PLP; PMP20; PRDX6; PRXV; SBBI10; prx-V; peroxiredoxin-5, mitochondrial; Alu co-repressor 1; TPx type VI; antioxidant enzyme B166; epididymis secretory protein Li 55; liver tissue 2D-page spot 71B; peroxiredoxin V; peroxisomal antioxidant enzyme; thioredoxin peroxidase PMP20; thioredoxin reductase; peroxiredoxin 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggactagctggcgtgtgcgccctgagacgctcagcgggctatatactcgtcggtggggccggcggtcagtctgcggcagcggcagcaagacggtgcagtgaaggagagtgggcgtctggcggggtccgcagtttcagcagagccgctgcagccatggccccaatcaaggtgggagatgccatcccagcagtggaggtgtttgaaggggagccagggaacaaggtgaacctggcagagctgttcaagggcaagaagggtgtgctgtttggagttcctggggccttcacccctggatgttccaagacacacctgccagggtttgtggagcaggctgaggctctgaaggccaagggagtccaggtggtggcctgtctgagtgttaatgatgcctttgtgactggcgagtggggccgagcccacaaggcggaaggcaaggttcggctcctggctgatcccactggggcctttgggaaggagacagacttattactagatgattcgctggtgtccatctttgggaatcgacgtctcaagaggttctccatggtggtacaggatggcatagtgaaggccctgaatgtggaaccagatggcacaggcctcacctgcagcctggcacccaatatcatctcacagctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline rich 10 - forkhead box B1 - synaptogyrin 4 - forkhead box R1 |