> >>NANOS3-nanos homolog 3 (Drosophila) Gene
NANOS3-nanos homolog 3 (Drosophila) Gene View larger

NANOS3-nanos homolog 3 (Drosophila) Gene

PTXBC101209

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of NANOS3-nanos homolog 3 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NANOS3-nanos homolog 3 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC101209
Product type: DNA & cDNA
Ncbi symbol: NANOS3
Origin species: Human
Product name: NANOS3-nanos homolog 3 (Drosophila) Gene
Size: 2ug
Accessions: BC101209
Gene id: 342977
Gene description: nanos homolog 3 (Drosophila)
Synonyms: NANOS1L; NOS3; ZC2HC12C; nanos homolog 3; nanos C2HC-type zinc finger 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggacctttgacctgtggacagattacctgggtttggcacacctggttagggctctgagtgggaaagagggtcctgaaaccaggctgagcccccagccagagccagagccaatgctggagccggtgtcagccctggagccgatgccagcgccggagtcggtgccagtgccgggacccaaggatcagaagcgcagcctggagtcctcgccagctcccgaacgcctgtgctctttctgcaaacacaacggcgagtcccgggccatctaccagtcccacgtgctgaaggacgaggctggcagggtgctgtgtcccatcctgcgggactacgtgtgtccccagtgcggcgccacacgtgagcgcgcccacacccgacgcttctgcccacttactggccagggctacacctccgtctacagccacaccacccgaaactcggcaggcaagaagctggtccggcctgacaaggcgaagacacaggacacaggccaccgccgaggaggaggaggaggagcaggtttcagaggtgccgggaagtctgagccttcgccctcctgctctccctccatgtccacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Tctex1 domain containing 1
- G protein-coupled receptor 35
- cysteine-rich PAK1 inhibitor
- G protein-coupled receptor 87

Reviews

Buy NANOS3-nanos homolog 3 (Drosophila) Gene now

Add to cart