CIB3-calcium and integrin binding family member 3 Gene View larger

CIB3-calcium and integrin binding family member 3 Gene

PTXBC112200

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CIB3-calcium and integrin binding family member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CIB3-calcium and integrin binding family member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC112200
Product type: DNA & cDNA
Ncbi symbol: CIB3
Origin species: Human
Product name: CIB3-calcium and integrin binding family member 3 Gene
Size: 2ug
Accessions: BC112200
Gene id: 117286
Gene description: calcium and integrin binding family member 3
Synonyms: KIP3; calcium and integrin-binding family member 3; DNA-dependent protein kinase catalytic subunit-interacting protein 3; calcium and integrin binding family member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaacaagcagacagtcttcacacacgagcagctggaagcgtatcaggactgcacatttttcacaaggaaggagatcatgaggctcttctatcgctaccaggacctggccccacagctcgtgcccctcgactataccacctgccccgatgtgaaggtgccctacgagctcattggcagcatgcccgagctgaaggacaaccccttccgccagaggattgcccaggtattctctgaggatggggatggccacatgaccctggacaactttttggacatgttttccgtgatgagtgaaatggctccccgcgacctcaaggcttactatgcttttaaaatttatgattttaacaacgacgactacatttgtgcgtgggacctggagcagacggtgaccaaactgacgcggggggagctgagtgccgaggaggtgagcctggtatgtgagaaggtgctggatgaggctgatggagaccatgatgggcggctgtccctggaagatttccagaacatgatcctccgggcaccagacttcctcagcaccttccacatccgaatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical gene supported by AK124070
- prolyl 4-hydroxylase, alpha polypeptide III
- prolyl 4-hydroxylase, alpha polypeptide III
- endoplasmic reticulum to nucleus signaling 1

Reviews

Buy CIB3-calcium and integrin binding family member 3 Gene now

Add to cart