Cart 3 Product Products 340,20 € (empty)
-
1 x HIST1H4A-h...113,40 € -
1 x C5orf23-ch...113,40 € -
1 x CSDC2-cold...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
Data sheet of KRTAP9-2-keratin associated protein 9-2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP9-2-keratin associated protein 9-2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC110619 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP9-2 |
| Origin species: | Human |
| Product name: | KRTAP9-2-keratin associated protein 9-2 Gene |
| Size: | 2ug |
| Accessions: | BC110619 |
| Gene id: | 83899 |
| Gene description: | keratin associated protein 9-2 |
| Synonyms: | KAP9.2; KRTAP9.2; keratin-associated protein 9-2; keratin-associated protein 9.2; ultrahigh sulfur keratin-associated protein 9.2; keratin associated protein 9-2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacccactgttgctccccttgctgtcagcctacatgctgcaggaccacctgctgcaggaccacctgctggaagcccaccactgtgaccacctgcagcagcacatcctgctgccagcccgcctgctgtgtgtccagctgctgccagccttgctgccgcccaacttcctgtcaaaacacctgctgtaggaccacctgctgccagcccacctgtgtgaccagctgctgccagccttcctgctgcagcacaccctgctgccagcccacctgctgtgggtccagctgctgtggccaaaccagctgtgggtccagctgtggccagagcagctcctgtgcacctgtgtactgcagaagaacctgctactaccccacgactgtctgcctgcctggttgcctaaaccagagctgtggctccaactgctgccagccgtgctgccgcccagcctgctgtgagaccacctgctgcaggaccacttgcttccagcccacctgtgtgtccagctgctgccagccttcttgctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 4-7 - methionine sulfoxide reductase B2 - shisa homolog 4 (Xenopus laevis) - coiled-coil domain containing 84 |