PTXBC098293
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC098293 |
Product type: | DNA & cDNA |
Ncbi symbol: | OGFOD2 |
Origin species: | Human |
Product name: | OGFOD2-2-oxoglutarate and iron-dependent oxygenase domain containing 2 Gene |
Size: | 2ug |
Accessions: | BC098293 |
Gene id: | 79676 |
Gene description: | 2-oxoglutarate and iron-dependent oxygenase domain containing 2 |
Synonyms: | 2-oxoglutarate and iron-dependent oxygenase domain-containing protein 2; 2-oxoglutarate and iron dependent oxygenase domain containing 2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcctaaggggaggcccaacaccatgaacaactacggggtgctgctgcacgagctcgggctggacgagccgctgatgacaccactgcgggagcgcttcctgcagccgctgatggccctgctgtaccctgactgtggcgggggccggctcgacagccaccgggcctttgtggtcaaatacgcaccgggccaggacctggagctgggctgccactatgataatgccgagctcaccctcaatgtggccttgggcaaggtcttcacagggggcgccctgtattttgggggcctcttccaggcacccacagccctgacggagcccctggaggtggagcacgtggtgggccagggtgtcctccaccgtggcggccagctgcatggagcccggcccttgggcactggtgagcgttggaaccttgtcgtctggctccgagcctctgctgtgcgcaacagcctctgtcccatgtgctgccgtgagcccgacctggtggacgatgagggcttcggtgatggcttcacccgagaggagcccgccacggtggatgtatgtgcgctcacctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - calcium/calmodulin-dependent serine protein kinase (MAGUK family) - solute carrier family 6 (proline IMINO transporter), member 20 - solute carrier family 22 (organic anion transporter), member 9 - 5-methyltetrahydrofolate-homocysteine methyltransferase reductase |