Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TXNDC6-thioredoxin domain containing 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TXNDC6-thioredoxin domain containing 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC107054 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TXNDC6 |
| Origin species: | Human |
| Product name: | TXNDC6-thioredoxin domain containing 6 Gene |
| Size: | 2ug |
| Accessions: | BC107054 |
| Gene id: | 347736 |
| Gene description: | thioredoxin domain containing 6 |
| Synonyms: | TXNDC6; NM23-H9; TXL-2; TXL2; thioredoxin domain-containing protein 6; NME gene family member 9; thioredoxin-like protein 2; NME/NM23 family member 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcagttccaaaggactaactgttgttgatgtctatcaaggctggtgtggcccctgcaaacctgtggtgagcctcttccagaagatgaggatcgaggtcggcctggaccttctgcactttgcattagcagaggcagatcgtcttgatgtcctcgaaaagtacagagggaagtgcgagccaacctttctgttttatgcaattaaagatgaggctctttctgatgaagatgaatgtgtttcccatggaaagaataatggtgaagatgaagacatggtttcatcagagaggacctgtaccttggccatcattaaaccagatgcagtggcccatggaaagactgatgagattatcatgaagattcaggaagctgggtttgaaattctaacaaatgaagagagaaccatgacagaggcagaagtgcgacttttctaccaacacaaagctggagagtctccgagctcagtacggcacagaaatgcccttcaatgccgtccatggaagccgggacagagaagatgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ40448 - hypothetical protein FLJ14816 - ras homolog gene family, member Q - glucagon-like peptide 1 receptor |