Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
Data sheet of IL1F9-interleukin 1 family, member 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL1F9-interleukin 1 family, member 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC098337 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL1F9 |
| Origin species: | Human |
| Product name: | IL1F9-interleukin 1 family, member 9 Gene |
| Size: | 2ug |
| Accessions: | BC098337 |
| Gene id: | 56300 |
| Gene description: | interleukin 1 family, member 9 |
| Synonyms: | IL1F9; IL-1F9; IL-1H1; IL-1RP2; IL1E; IL1H1; IL1RP2; interleukin-36 gamma; IL-1 related protein 2; IL-1(EPSILON); IL-1-epsilon; interleukin 1-related protein 2; interleukin-1 epsilon; interleukin-1 family member 9; interleukin-1 homolog 1; interleukin 36, gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagaggcactccaggagacgctgatggtggaggaagggccgtctatcaatcaatgtgtaaacctattactgggactattaatgatttgaatcagcaagtgtggacccttcagggtcagaaccttgtggcagttccacgaagtgacagtgtgaccccagtcactgttgctgttatcacatgcaagtatccagaggctcttgagcaaggcagaggggatcccatttatttgggaatccagaatccagaaatgtgtttgtattgtgagaaggttggagaacagcccacattgcagctaaaagagcagaagatcatggatctgtatggccaacccgagcccgtgaaacccttccttttctaccgtgccaagactggtaggacctccacccttgagtctgtggccttcccggactggttcattgcctcctccaagagagaccagcccatcattctgacttcagaacttgggaagtcatacaacactgcctttgaattaaatataaatgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leukemia NUP98 fusion partner 1 - non-protein coding RNA 85 - amino-terminal enhancer of split - myosin binding protein H-like |