Cart 17 Product Products 1 992,60 € (empty)
-
1 x EFNB1-ephr...121,50 € -
1 x RCBTB1-reg...121,50 € -
1 x STAG3L4-st...113,40 € -
1 x GBL-G...121,50 € -
1 x DNAJA3-Dna...121,50 € -
1 x XCL1-chemo...113,40 € -
1 x MFAP3L-mic...113,40 € -
1 x ZBTB26-zin...121,50 € -
1 x AGPAT1-1-a...113,40 € -
1 x TMEM14C-tr...113,40 € -
1 x RNASE1-rib...113,40 € -
1 x RAC1-ras-r...113,40 € -
1 x CRADD-CASP...113,40 € -
1 x SGCD-sarco...121,50 € -
1 x TBRG1-tran...113,40 € -
1 x AQP12B-aqu...121,50 € -
1 x CER1-cerbe...121,50 €
No products
To be determined Shipping
1 992,60 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 992,60 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 992,60 €
Data sheet of BTG2-BTG family, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BTG2-BTG family, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC105949 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BTG2 |
| Origin species: | Human |
| Product name: | BTG2-BTG family, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC105949 |
| Gene id: | 7832 |
| Gene description: | BTG family, member 2 |
| Synonyms: | protein BTG2; APRO1; PC3; TIS21; B-cell translocation gene 2; BTG family member 2; NGF-inducible anti-proliferative protein PC3; nerve growth factor-inducible anti-proliferative; pheochromacytoma cell-3; BTG anti-proliferation factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccacgggaagggaaccgacatgctcccggagatcgccgccgccgtgggcttcctctccagcctcctgaggacccggggctgcgtgagcgagcagaggcttaaggtcttcagcggggcgctccaggaggcactcacagagcactacaaacaccactggtttcccgaaaagccgtccaagggctccggctaccgctgcattcgcatcaaccacaagatggaccccatcatcagcagggtggccagccagatcggactcagccagccccagctgcaccagctgctgcccagcgagctgaccctgtgggtggacccctatgaggtgtcctaccgcattggggaggacggctccatctgcgtcttgtacgaggaggccccactggccgcctcctgtgggctcctcacctgcaagaaccaagtgctgctgggccggagcagcccctccaagaactacgtgatggcagtctccagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - crystallin, gamma B - crystallin, gamma N - FLJ41423 protein - crystallin, gamma D |