> >>VHLL-von Hippel-Lindau tumor suppressor-like Gene
VHLL-von Hippel-Lindau tumor suppressor-like Gene View larger

VHLL-von Hippel-Lindau tumor suppressor-like Gene

PTXBC130596

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of VHLL-von Hippel-Lindau tumor suppressor-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VHLL-von Hippel-Lindau tumor suppressor-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC130596
Product type: DNA & cDNA
Ncbi symbol: VHLL
Origin species: Human
Product name: VHLL-von Hippel-Lindau tumor suppressor-like Gene
Size: 2ug
Accessions: BC130596
Gene id: 391104
Gene description: von Hippel-Lindau tumor suppressor-like
Synonyms: VHLP; VLP; von Hippel-Lindau-like protein; VHL pseudogene; VHL-like protein; von Hippel-Lindau tumor suppressor like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccctggagagcggggaacggggtgggtttagaggcccaggcgggcacccaggaggcaggcccagaagagtactgccaggaagagttgggcgccgaggaggagatggcagccagagcagcatggcctgtgctgcgctctgtgaactcacgcgagctctcccggatcatcatctgcaatcacagcccacgaatcgtgctgcctgtgtggctcaactactatggcaagctgctgccctacctgacgctgctgcccggcagggacttccgcatccacaacttccgaagccacccttggctcttcagagatgcaaggacacatgataagcttctggttaaccaaactgaattgtttgtgccatcttccaatgttaatggacagcctgtttttgccaacatcacactgcagtgtataccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 15 open reading frame 32
- interleukin 28B (interferon, lambda 3)
- chromosome 17 open reading frame 65
- chromosome 21 open reading frame 67

Reviews

Buy VHLL-von Hippel-Lindau tumor suppressor-like Gene now

Add to cart