Cart 3 Product Products 342,04 € (empty)
-
-
1 x IGF2-insul...113,40 € -
1 x HDGFRP3-he...113,40 €
No products
To be determined Shipping
342,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 342,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 342,04 €
View larger 
PPP1R11-protein phosphatase 1, regulatory (inhibitor) subunit 11 Gene
PTXBC102010
New product
Data sheet of PPP1R11-protein phosphatase 1, regulatory (inhibitor) subunit 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP1R11-protein phosphatase 1, regulatory (inhibitor) subunit 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC102010 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1R11 |
| Origin species: | Human |
| Product name: | PPP1R11-protein phosphatase 1, regulatory (inhibitor) subunit 11 Gene |
| Size: | 2ug |
| Accessions: | BC102010 |
| Gene id: | 6992 |
| Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 11 |
| Synonyms: | CFAP255; HCG-V; HCGV; IPP3; TCTE5; TCTEX5; protein phosphatase 1 regulatory subunit 11; HCG V; hemochromatosis candidate gene V protein; inhibitor-3; protein phosphatase 1, regulatory (inhibitor) subunit 11; protein phosphatase inhibitor 3; t-complex-associated-testis-expressed 5; protein phosphatase 1 regulatory inhibitor subunit 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgaggcaggggctgggctgagcgagaccgtcactgagacaacggttaccgtgacaaccgagcccgagaaccggagccttaccatcaaacttcggaaacggaagccagagaaaaaggtagaatggacaagtgacactgtggacaatgaacacatgggccgccgctcatccaaatgctgctgtatttatgagaaacctcgggcctttggcgagagctccacggaaagtgatgaggaggaagaagagggctgtggtcatacacactgtgtacgtggccaccgcaaaggacggcgtcgtgcaaccctaggaccgacccccaccacccctccccagcctcctgacccttcccagccccctccagggccaatgcagcactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 5-hydroxytryptamine (serotonin) receptor 3 family member D - regulatory factor X-associated ankyrin-containing protein - asparagine-linked glycosylation 13 homolog (S. cerevisiae) - protein phosphatase 1, regulatory (inhibitor) subunit 3A |