Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FBXL21-F-box and leucine-rich repeat protein 21 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FBXL21-F-box and leucine-rich repeat protein 21 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106753 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FBXL21 |
| Origin species: | Human |
| Product name: | FBXL21-F-box and leucine-rich repeat protein 21 Gene |
| Size: | 2ug |
| Accessions: | BC106753 |
| Gene id: | 26223 |
| Gene description: | F-box and leucine-rich repeat protein 21 |
| Synonyms: | FBL3B; FBXL3B; FBXL3P; Fbl21; F-box/LRR-repeat protein 21; F-box and leucine-rich repeat protein 21; F-box and leucine-rich repeat protein 3 pseudogene; F-box and leucine-rich repeat protein 3B; F-box protein Fbl3b; F-box/LRR-repeat protein 3B; F-box and leucine rich repeat protein 21 (gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacttctttctatatgaagaggaattcgagacgttcttcaaagaagaaacccctgttactcacctttattttggtcgttcagtcagcaaagtggttttaggacgggtaggtctcaactgtcctcgactgattgagttagtggtgtgtgctaatgatcttcagcctcttgataatgaacttatttgtattgctgaacactgtacaaacctaacagccttgggcctcagcaaatgtgaagttagctgcagtgccttcatcaggtttgtaagactgtgtgagagaaggttaacacagctctctgtaatggaggaagttttgatccctgatgaggattatagcctagatgaaattcacactgaagtctccaaatacctgggaagagtatggttccctgatgtgatgcctctctggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box and leucine-rich repeat protein 15 - F-box and leucine-rich repeat protein 17 - cholinergic receptor, nicotinic, alpha 9 - zinc finger and BTB domain containing 7A |