Cart 12 Product Products 15 070,01 € (empty)
-
-
1 x MRPL14-mit...113,40 € -
1 x PFDN5-pref...113,40 € -
1 x HSD11B1L-h...113,40 € -
1 x BCAS1-brea...121,50 € -
1 x PARP6-poly...113,40 € -
-
-
1 x C17orf62-c...113,40 € -
1 x RTN4-retic...121,50 € -
-
No products
To be determined Shipping
15 070,01 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 15 070,01 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 15 070,01 €
Data sheet of KNCN-kinocilin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KNCN-kinocilin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101295 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KNCN |
| Origin species: | Human |
| Product name: | KNCN-kinocilin Gene |
| Size: | 2ug |
| Accessions: | BC101295 |
| Gene id: | 148930 |
| Gene description: | kinocilin |
| Synonyms: | Kino; kinocilin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaggcaaagtctgagcggctgcccatgccctgccctcccgtcctgcctgctgcccctatgtcagtgccctcctgggttaggagacccggaccggagacaagccaggccctgcagaccccagagcggctgggaacagtgtctggaatggggccttttgcactcgcccggccaagcctctccaaaatggattccactggtgtgggctgggacctggagcaaggtgtcgccggacgcccccacagggttcccatgtttcaggctcctgccctggcctttctttctggactgcagctcagctttgttgcctgttcaatctactgatttgtttctctggaatttggggtccaaggccctgactatgaccaggatgccccagtcccttgctctaacccggctacagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - relaxin 2 - septin 7 - T-box 10 - tektin 5 |