Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GIYD2-GIY-YIG domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GIYD2-GIY-YIG domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130545 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GIYD2 |
| Origin species: | Human |
| Product name: | GIYD2-GIY-YIG domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC130545 |
| Gene id: | 79008 |
| Gene description: | GIY-YIG domain containing 2 |
| Synonyms: | GIYD2; structure-specific endonuclease subunit SLX1; GIY-YIG domain-containing protein 1; SLX1 structure-specific endonuclease subunit homolog B; SLX1A; SLX1 homolog B, structure-specific endonuclease subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtcccgcgggggtcgcggcgaggccagggcgctttttcggcgtctacctgctctactgcctgaacccccggtaccggggccgcgtctacgtggggttcactgtcaacactgctcgtcgggtccagcagcacaatgggggccgcaaaaaaggcggggcctggcggaccagcgggcgagggccctgggagatggtgctcgtcgtgcacggcttcccgtcctccgtggccgcccttcgggatgaagaggggcccttgtgttgcccccaccctggctgcctgctaagggcccatgtgatctgcctggcagaggagtttcttcaggaagaaccagggcagcttctgcccctagagggccaatgcccttgctgtgagaagtcactgctttggggagacctgatctggctgtgccagatggacactgagaaagaagtagaagactcagaattagaagaggcacactggacagacctgctggagacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ret finger protein-like 4B - transmembrane protein 182 - deoxyribonuclease II beta - jumonji domain containing 4 |