Cart 24 Product Products 2 790,62 € (empty)
-
1 x PAPOLA-pol...121,50 € -
1 x RSPH10B2-r...121,50 € -
1 x PDE4D-phos...113,40 € -
1 x BIN3-bridg...113,40 € -
1 x GALNT3-UDP...113,40 € -
1 x PRKCSH-pro...121,50 € -
1 x KIR3DX1-ki...113,40 € -
1 x CYP20A1-cy...121,50 € -
1 x TUBB2A-tub...121,50 € -
1 x PTPRK-prot...113,40 € -
1 x NDUFA13-NA...113,40 € -
1 x LYZL4-lyso...113,40 € -
1 x GAGE5-G...113,40 € -
1 x NF2-neurof...113,40 € -
1 x BHMT-betai...121,50 € -
1 x PTENP1-pho...121,50 € -
1 x KRT80-kera...121,50 € -
1 x ZFAND5-zin...113,40 € -
1 x ZDHHC6-zin...121,50 € -
1 x BTNL9-buty...121,50 € -
1 x SDHC-succi...113,40 € -
1 x IL1F10-int...113,40 € -
-
No products
To be determined Shipping
2 790,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 24 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 790,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 790,62 €
View larger 
RNASE3-ribonuclease, RNase A family, 3 (eosinophil cationic protein) Gene
PTXBC096060
New product
Data sheet of RNASE3-ribonuclease, RNase A family, 3 (eosinophil cationic protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNASE3-ribonuclease, RNase A family, 3 (eosinophil cationic protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096060 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNASE3 |
| Origin species: | Human |
| Product name: | RNASE3-ribonuclease, RNase A family, 3 (eosinophil cationic protein) Gene |
| Size: | 2ug |
| Accessions: | BC096060 |
| Gene id: | 6037 |
| Gene description: | ribonuclease, RNase A family, 3 (eosinophil cationic protein) |
| Synonyms: | ECP; RAF1; RNS3; RNase 3; cytotoxic ribonuclease; ribonuclease 3; ribonuclease, RNase A family, 3; ribonuclease A family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttccaaaactgttcacttcccaaatttgtctgcttcttctgttggggcttatgggtgtggagggctcactccatgccagacccccacagtttacgagggctcagtggtttgccatccagcacatcagtctgaacccccctcgatgcaccattgcaatgcgggcaattaacaattatcgatggcgttgcaaaaaccaaaatacttttcttcgtacaacttttgctaatgtagttaatgtttgtggtaaccaaagtatacgctgccctcataacagaactctcaacaattgtcatcggagtagattccgggtgcctttactccactgtgacctcataaatccaggtgcacagaatatttcaaactgcaggtatgcagacagaccaggaaggaggttctatgtagttgcatgtgacaacagagatccacgggattctccacggtatcctgtggttccagttcacctggataccaccatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF - serpin peptidase inhibitor, clade B (ovalbumin), member 11 - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 - protein phosphatase 2C, magnesium-dependent, catalytic subunit |