LCN8-lipocalin 8 Gene View larger

LCN8-lipocalin 8 Gene

PTXBC130465

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LCN8-lipocalin 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LCN8-lipocalin 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC130465
Product type: DNA & cDNA
Ncbi symbol: LCN8
Origin species: Human
Product name: LCN8-lipocalin 8 Gene
Size: 2ug
Accessions: BC130465
Gene id: 138307
Gene description: lipocalin 8
Synonyms: EP17; LCN5; epididymal-specific lipocalin-8; lipocalin 5; lipocalin 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagctggaccggcagaagattggaggattctggagggaagtcggtgtggcctccgatcaaagcctggtgctgacggccccgaagcgggtggagggcttgttcctcaccttgagcgggagtaacctgaccgtgaaggttgcatataacagctcaggaagctgtgagatagagaagatcgtgggctcagaaatagacagtacgggaaaattcgcttttcctggccacagagagatccacgtgctggacaccgactacgagggctacgccatcctgcgggtgtccctgatgtggcggggcaggaactttcgcgtcctcaagtactttactcggagccttgaggacaaggaccggctggggttctggaagtttcgggagctgacagcagacactggtctctacctggcggcccggcctgggcggtgtgccgagctcctgaaggaggagctgatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - akirin 1
- uroplakin 2
- keratin 6C
- matrilin 4

Reviews

Buy LCN8-lipocalin 8 Gene now

Add to cart