Cart 10 Product Products 1 129,93 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 € -
1 x LENG1-leuk...113,40 €
No products
To be determined Shipping
1 129,93 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 129,93 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 129,93 €
Data sheet of FLJ33360-FLJ33360 protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ33360-FLJ33360 protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132707 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ33360 |
| Origin species: | Human |
| Product name: | FLJ33360-FLJ33360 protein Gene |
| Size: | 2ug |
| Accessions: | BC132707 |
| Gene id: | 401172 |
| Gene description: | FLJ33360 protein |
| Synonyms: | FLJ33360 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacggcacctgcattgagagaagacggcaatggtatcgtgatgatctacctctttgctttaaaaaggaagaaaatcctccatccaacaacgtagatggccctggaggatgttatgccaagtgcaagaagaaacgagaaggacaaatgctacatgatctcattcctatgggccctgcaacagccacatccttcttgactgaagacattggccttgccttctatcaggtttcccctctcctggggttcctctgcctgctctctcaagacacatggaacatgtacacgtgcccaagatggatcggccgctcagccgagcctcccagtgctgcctgccaggctggagggacccgtcttctagggacattgcactcccctgctcttctgagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FLJ42957 protein - BTG family, member 2 - crystallin, gamma B - crystallin, gamma N |