Cart 13 Product Products 1 761,35 € (empty)
-
1 x C2orf76-ch...113,40 € -
1 x BCL7C-B-ce...113,40 € -
-
1 x C6orf208-c...113,40 € -
1 x FDC-SP...259,07 € -
-
-
1 x C19orf60-c...113,40 € -
1 x C15orf15-c...113,40 € -
1 x C3orf10-ch...113,40 € -
-
-
1 x PRKAB2-pro...121,50 €
No products
To be determined Shipping
1 761,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 761,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 761,35 €
Data sheet of OSTbeta-organic solute transporter beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OSTbeta-organic solute transporter beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103842 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OSTbeta |
| Origin species: | Human |
| Product name: | OSTbeta-organic solute transporter beta Gene |
| Size: | 2ug |
| Accessions: | BC103842 |
| Gene id: | 123264 |
| Gene description: | organic solute transporter beta |
| Synonyms: | OSTBETA; OSTB; organic solute transporter subunit beta; OST-beta; organic solute transporter beta subunit; solute carrier family 51 subunit beta; solute carrier family 51 beta subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcacagtgagggggctcccggagacccagccggtactgtggtaccccaggagctgctggaagagatgctttggttttttcgtgtggaagatgcatctccctggaatcattccatccttgccctggcagctgtggtggtcattataagcatggtcctcctgggaagaagcatccaggcaagcagaaaagaaaagatgcagccaccagaaaaagaaactccagaagtcctgcatttggatgaggccaaggatcacaacagcctaaacaacctaagagaaactttgctctcagaaaagccaaacttggcccaggtggaacttgagttaaaagagagagatgtgctgtcagttttccttccggatgtaccagaaactgagagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 9-2 - keratin associated protein 4-7 - methionine sulfoxide reductase B2 - shisa homolog 4 (Xenopus laevis) |