PTXBC098165
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC098165 |
Product type: | DNA & cDNA |
Ncbi symbol: | LOC729355 |
Origin species: | Human |
Product name: | LOC729355-similar to TP53TG3 protein Gene |
Size: | 2ug |
Accessions: | BC098165 |
Gene id: | 729355 |
Gene description: | similar to TP53TG3 protein |
Synonyms: | TP53TG3E; TP53TG3F; TP53-target gene 3 protein; TP53-inducible gene 3 protein; TP53 target 3B |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcgcgcctcaccctgcatctcccagcccgcagccagctggcatcctagaccctctgccctgcgaccaacagccgggagcggaccagacaccagaactcccggaacggttgaagacggttccgctccctgtcccgcctttcgcagcccagcagtttcgccctgcggagaggagccttgctgtttccaaatctctcctgctgaagagacattggagctagggcggctagtttcacctggtaattgtgacaccctgtctcctcgagctgcaggcttttatgcttgtcatgttcgaagtttgataccttgcagatcaacaaagggccggtggcctctcactgcctccgcggcagggttgtcaagtttttcaggttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - interferon responsive gene 15 - interleukin 1 family, member 9 - leukemia NUP98 fusion partner 1 - non-protein coding RNA 85 |