Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CPLX4-complexin 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CPLX4-complexin 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106887 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CPLX4 |
| Origin species: | Human |
| Product name: | CPLX4-complexin 4 Gene |
| Size: | 2ug |
| Accessions: | BC106887 |
| Gene id: | 339302 |
| Gene description: | complexin 4 |
| Synonyms: | CPX-IV; CPXIV; complexin-4; CPX IV; complexin IV; complexin 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctttccttatgaaaagtatgataagtaaccaggtaaagaatttaggatttggtggtgggtctgaagaaaataaagaagaaggaggtgcatctgatcctgcagcagctcaagggatgactagagaggagtatgaggagtatcaaaagcaaatgattgaggagaagatggaaagagatgctgcatttacacagaaaaaggcagaaagggcatgcctcagagttcatctcagagaaaaatacaggctcccaaagagtgaaatggatgagaatcaaatccagatggctggagatgatgtggatttacctgaagatctccggaaaatggtagatgaagatcaagaagaggaagaagataaagattctattcttgggcagatacagaatctccagaacatggacttggataccataaaagaaaaagcccaggccaccttcactgaaatcaagcagacagcggagcagaagtgttccgtgatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - KIAA0040 - Xg blood group - homeobox B5 - homeobox A2 |