Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
View larger 
Data sheet of IL1F10-interleukin 1 family, member 10 (theta) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL1F10-interleukin 1 family, member 10 (theta) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103966 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL1F10 |
| Origin species: | Human |
| Product name: | IL1F10-interleukin 1 family, member 10 (theta) Gene |
| Size: | 2ug |
| Accessions: | BC103966 |
| Gene id: | 84639 |
| Gene description: | interleukin 1 family, member 10 (theta) |
| Synonyms: | FIL1-theta; FKSG75; IL-1HY2; IL-38; IL1-theta; IL1HY2; interleukin-1 family member 10; FIL1 theta; IL-1 theta; IL-1F10 (canonical form IL-1F10a); family of interleukin 1-theta; interleukin-1 HY2; interleukin-1 receptor antagonist FKSG75; interleukin-1 receptor antagonist-like FIL1 theta; interleukin-38; interleukin 1 family member 10 (theta) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgttccctccccatggcaagatactacataattaaatatgcagaccagaaggctctatacacaagagatggccagctgctggtgggagatcctgttgcagacaactgctgtgcagagaagatctgcacacttcctaacagaggcttggaccgcaccaaggtccccattttcctggggatccagggagggagccgctgcctggcatgtgtggagacagaagaggggccttccctacagctggaggatgtgaacattgaggaactgtacaaaggtggtgaagaggccacacgcttcaccttcttccagagcagctcaggctccgccttcaggcttgaggctgctgcctggcctggctggttcctgtgtggcccggcagagccccagcagccagtacagctcaccaaggagagtgagccctcagcccgtaccaagttttactttgaacagagctggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 21 open reading frame 123 - interleukin 1 family, member 6 (epsilon) - chromosome 10 open reading frame 114 - placenta-specific 2 (non-protein coding) |