Cart 12 Product Products 1 406,88 € (empty)
-
1 x PCMTD2-pro...113,40 € -
1 x NPFFR1-neu...121,50 € -
1 x THG1L-tRNA...121,50 € -
1 x CHST11-car...121,50 € -
1 x SNX8-sorti...121,50 € -
1 x ZNF511-zin...113,40 € -
-
1 x MRPL43-mit...113,40 € -
1 x CCDC94-coi...121,50 € -
1 x DIP2A-DIP2...113,40 € -
1 x TMEM129-tr...121,50 € -
1 x NPAL3-NIPA...121,50 €
No products
To be determined Shipping
1 406,88 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 406,88 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 406,88 €
Data sheet of TMEM211-transmembrane protein 211 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM211-transmembrane protein 211 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130647 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM211 |
| Origin species: | Human |
| Product name: | TMEM211-transmembrane protein 211 Gene |
| Size: | 2ug |
| Accessions: | BC130647 |
| Gene id: | 255349 |
| Gene description: | transmembrane protein 211 |
| Synonyms: | bA9F11.1; transmembrane protein 211 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcctcggaggctggctcctgttggccttcaatgcaattttcctcctgtcttgggctgtggcccccaaagggctgtgcccaaggagaagcagtgttccaatgccaggggtgcaggcagtggcagctactgccatgattgtgggtctgctgattttcccaatcggccttgcctccccattcatcaaggaagtgtgcgaagcctcctccatgtattatggtgggaagtgccggctgggttggggttacatgactgctatcctcaatgcagtcctggccagcctcctgcccatcatcagctggccccacacaaccaaggtccaagggaggaccatcatcttctccagtgccaccgagagaatcatctttgtgccagaaatgaacaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone cluster 1, H2ak - histone cluster 1, H2bo - histone cluster 1, H2bb - histone cluster 1, H2ai |