Cart 1 Product Products 113,40 € (empty)
-
1 x HIST1H4A-h...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
PLP2-proteolipid protein 2 (colonic epithelium-enriched) Gene
PTXBC109066
New product
Data sheet of PLP2-proteolipid protein 2 (colonic epithelium-enriched) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLP2-proteolipid protein 2 (colonic epithelium-enriched) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109066 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLP2 |
| Origin species: | Human |
| Product name: | PLP2-proteolipid protein 2 (colonic epithelium-enriched) Gene |
| Size: | 2ug |
| Accessions: | BC109066 |
| Gene id: | 5355 |
| Gene description: | proteolipid protein 2 (colonic epithelium-enriched) |
| Synonyms: | A4LSB; proteolipid protein 2; A4 differentiation-dependent protein; differentiation-dependent protein A4; intestinal membrane A4 protein; proteolipid protein 2 (colonic epithelium-enriched) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggattctgagcgcctctcggctcctggctgctgggccgcctgcaccaacttctcgcgcactcgaaagggaatcctcctgtttgctgagattatattatgcctggtgatcctgatctgcttcagtgcctccacaccaggctactcctccctgtcggtgattgagatgatccttgctgctattttctttgttgtctacatgtgtgacctgcacaccaagataccattcatcaactggccctggagtgatttcttccgaaccctcatagcggcaatcctctacctgatcacctccattgttgtccttgttgagagaggaaaccactccaaaatcgtcgcaggggtactgggcctaatcgctacgtgcctctttggctatgatgcctatgtcaccttccccgttcggcagccaagacatacagcagcccccactgaccccgcagatggcccggtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fibroblast growth factor 9 (glia-activating factor) - LON peptidase N-terminal domain and ring finger 1 - opioid binding protein/cell adhesion molecule-like - doublesex and mab-3 related transcription factor 3 |