Cart 6 Product Products 851,50 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 € -
1 x MR1-major...121,50 € -
-
1 x FLJ34048-h...113,40 €
No products
To be determined Shipping
851,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 851,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 851,50 €
View larger 
AHSA2-AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) Gene
PTXBC113671
New product
Data sheet of AHSA2-AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AHSA2-AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113671 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AHSA2 |
| Origin species: | Human |
| Product name: | AHSA2-AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC113671 |
| Gene id: | 130872 |
| Gene description: | AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) |
| Synonyms: | activator of 90 kDa heat shock protein ATPase homolog 2; AHA1, activator of heat shock protein ATPase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattttaccaacgaaagctatggcaacccaggaattgactgtcaaaagaaaactgagtgggaataccctgcaggttcaggcctcatctccagtggcactgggtgtaaggattcccactgtggctcttcacatgatggaactgtttgacacaactgtagagcagctgtatagcatcttcactgtaaaggagttaacaaataagaagatcatcatgaaatggagatgtgggaactggccagaagaacactatgccatggttgcactgaattttgtgcctactctagggcaaacagaattacaattgaaggagttcctatctatctgtaaagaagagaacatgaaattctgttggcagaagcagcattttgaagaaataaaaggttcactgcagctgacccccctaaatggttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 - ELOVL family member 7, elongation of long chain fatty acids (yeast) - M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) - potassium voltage-gated channel, subfamily H (eag-related), member 1 |