Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ASIP-agouti signaling protein, nonagouti homolog (mouse) Gene
PTXBC104238
New product
Data sheet of ASIP-agouti signaling protein, nonagouti homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASIP-agouti signaling protein, nonagouti homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104238 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASIP |
| Origin species: | Human |
| Product name: | ASIP-agouti signaling protein, nonagouti homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC104238 |
| Gene id: | 434 |
| Gene description: | agouti signaling protein, nonagouti homolog (mouse) |
| Synonyms: | AGSW; AGTI; AGTIL; ASP; SHEP9; agouti-signaling protein; agouti signaling protein, nonagouti homolog; agouti switch protein; nonagouti homolog; agouti signaling protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgtcacccgcttactcctggccaccctgctggtcttcctctgcttcttcactgccaacagccacctgccacctgaggagaagctccgagatgacaggagcctgagaagcaactcctctgtgaacctactggatgtcccttctgtctctattgtggcgctgaacaagaaatccaaacagatcggcagaaaagcagcagaaaagaaaagatcttctaagaaggaggcttcgatgaagaaagtggtgcggccccggacccccctatctgcgccctgcgtggccacccgcaacagctgcaagccgccggcacccgcctgctgcgacccgtgcgcctcctgccagtgccgcttcttccgcagcgcctgctcctgccgcgtgctcagcctcaactgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteolipid protein 2 (colonic epithelium-enriched) - fibroblast growth factor 9 (glia-activating factor) - LON peptidase N-terminal domain and ring finger 1 - opioid binding protein/cell adhesion molecule-like |