Cart 4 Product Products 623,57 € (empty)
-
1 x TYMP-thymi...121,50 € -
1 x C6orf58-ch...121,50 € -
1 x Olfactory...259,07 € -
1 x CFI-comple...121,50 €
No products
To be determined Shipping
623,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 623,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 623,57 €
Data sheet of ZNF663-zinc finger protein 663 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF663-zinc finger protein 663 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100775 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF663 |
| Origin species: | Human |
| Product name: | ZNF663-zinc finger protein 663 Gene |
| Size: | 2ug |
| Accessions: | BC100775 |
| Gene id: | 100130934 |
| Gene description: | zinc finger protein 663 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacacaggagaaaaacctgatgagtgtaaagaaaatgagaaagccttgaagaagttataccatactcaaaatgagagaactcatgcaggagagaaagtctatgattgtaagaaatgtgggaaattctttcatgaaaaagcatgccttactcaacatcagagaacccacacaacaggaaaacccagcaagtgtaatgatagtgaaagagtcttgaaggaatcttgcctcactcccaatcagagaattaaaacaagattaaaacaagagagaaaaactgtaaaggtaataaatgtgagaaacctttctttgagaagttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - bolA homolog 2 (E. coli) - MORN repeat containing 5 - hypothetical FLJ44006 - zinc finger protein 138 |