NEDD8-neural precursor cell expressed, developmentally down-regulated 8 Gene View larger

NEDD8-neural precursor cell expressed, developmentally down-regulated 8 Gene

PTXBC104201

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEDD8-neural precursor cell expressed, developmentally down-regulated 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NEDD8-neural precursor cell expressed, developmentally down-regulated 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC104201
Product type: DNA & cDNA
Ncbi symbol: NEDD8
Origin species: Human
Product name: NEDD8-neural precursor cell expressed, developmentally down-regulated 8 Gene
Size: 2ug
Accessions: BC104201
Gene id: 4738
Gene description: neural precursor cell expressed, developmentally down-regulated 8
Synonyms: ubiquitin-like protein Nedd8; NEDD-8; neddylin; neural precursor cell expressed, developmentally down-regulated 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctaattaaagtgaagacgctgaccggaaaggagattgagattgacattgaacctacagacaaggtggagcgaatcaaggagcgtgtggaggagaaagagggaatccccccacaacagcagaggctcatctacagtggcaagcagatgaatgatgagaagacagcagctgattacaagattttaggtggttcagtccttcacctggtgttggctctgagaggaggaggtggtcttaggcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial)
- phospholysine phosphohistidine inorganic pyrophosphate phosphatase
- RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
- potassium voltage-gated channel, Shal-related subfamily, member 3

Reviews

Buy NEDD8-neural precursor cell expressed, developmentally down-regulated 8 Gene now

Add to cart