Cart 1 Product Products 113,40 € (empty)
-
1 x APOBEC3C-a...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of GABARAP-GABA(A) receptor-associated protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GABARAP-GABA(A) receptor-associated protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106749 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GABARAP |
| Origin species: | Human |
| Product name: | GABARAP-GABA(A) receptor-associated protein Gene |
| Size: | 2ug |
| Accessions: | BC106749 |
| Gene id: | 11337 |
| Gene description: | GABA(A) receptor-associated protein |
| Synonyms: | GABARAP-a; ATG8A; MM46; gamma-aminobutyric acid receptor-associated protein; GABA(A) receptor-associated protein; GABA type A receptor-associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagttcgtgtacaaagaagagcatccgttcgagaagcgccgctctgagggcgagaagatccgaaagaaatacccggaccgggtgccggtgatagtagaaaaggctcccaaagctcggataggagacctggacaaaaagaaatacctggtgccttctgatctcacagttggtcagttctacttcttgatccggaagcgaattcatctccgagctgaggatgccttgtttttctttgtcaacaatgtcattccacccaccagtgccacaatgggtcagctgtaccaggaacaccatgaagaagacttctttctctacattgcctacagtgacgaaagtgtctacggtctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lipopolysaccharide-induced TNF factor - CD3g molecule, gamma (CD3-TCR complex) - SRY (sex determining region Y)-box 14 - coiled-coil domain containing 102B |