Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C2orf12-chromosome 2 open reading frame 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C2orf12-chromosome 2 open reading frame 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC065192 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C2orf12 |
| Origin species: | Human |
| Product name: | C2orf12-chromosome 2 open reading frame 12 Gene |
| Size: | 2ug |
| Accessions: | BC065192 |
| Gene id: | 192137 |
| Gene description: | chromosome 2 open reading frame 12 |
| Synonyms: | C2orf12; HCC-4; MSSP-1; MSSP-2; MSSP-3; SCR2; YC1; RNA-binding motif, single-stranded-interacting protein 1; c-myc gene single strand binding protein 2; cervical cancer oncogene 4; single-stranded DNA-binding protein MSSP-1; suppressor of CDC2 with RNA-binding motif 2; suppressor of cdc 2 (cdc13) with RNA binding motif 2; RNA binding motif single stranded interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtatggacacacacaaacaaaaaagcatgaaggaagatttggatccaagcagtgccacactttacatcatcactacaagtgttcaagtgtaaagaaaaccaattttgaaactatgaaattcctgattcataaatacacagttatttctactttagtacatataagataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 2 open reading frame 82 - chromosome 1 open reading frame 53 - chromosome 5 open reading frame 48 - chromosome 2 open reading frame 76 |