TMEM218-transmembrane protein 218 Gene

View larger

TMEM218-transmembrane protein 218 Gene

Reference: PTXBC132716

Condition: New product

Print

Data sheet of TMEM218-transmembrane protein 218 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about TMEM218-transmembrane protein 218 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC132716
Product type:	DNA & cDNA
Ncbi symbol:	TMEM218
Origin species:	Human
Product name:	TMEM218-transmembrane protein 218 Gene
Size:	2ug
Accessions:	BC132716
Gene id:	219854
Gene description:	transmembrane protein 218
Synonyms:	transmembrane protein 218
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggctggcactgtgctcggagtcggtgcgggcgtgttcatcttagccctgctctgggtggcagtgctgctgctgtgtgtgctgctgtccagagcctccggggcggcgaggttctctgtcatttttttattcttcggtgctgtgatcatcacatcagttctgttgcttttcccgcgagctggtgaattcccagccccagaagtggaagttaagattgtggatgactttttcattggccgctatgtcctgctggctttccttagtgccatcttccttggaggcctcttcttggttttaatccattatgttctggagccgatctatgccaaaccactgcactcctactga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- KCNQ1 downstream neighbor - transmembrane protein 211 - histone cluster 1, H2ak - histone cluster 1, H2bo

Reviews

Be the first to write your review !

Buy TMEM218-transmembrane protein 218 Gene now