TMEM64-transmembrane protein 64 Gene

View larger

TMEM64-transmembrane protein 64 Gene

Reference: PTXBC113828

Condition: New product

Print

Data sheet of TMEM64-transmembrane protein 64 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about TMEM64-transmembrane protein 64 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC113828
Product type:	DNA & cDNA
Ncbi symbol:	TMEM64
Origin species:	Human
Product name:	TMEM64-transmembrane protein 64 Gene
Size:	2ug
Accessions:	BC113828
Gene id:	169200
Gene description:	transmembrane protein 64
Synonyms:	transmembrane protein 64
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgcctccacgtattactgatctctcattacccaactatctgatggcatcttcggttggactgcttcctacccagcttctgaattcttacttgggtaccaccctgcggacaatggaagatgtcattgcagaacagagtgttagtggatattttgttttttgtttacagattattataagtataggcctcatgttttatgtagttcatcgagctcaagtggaattgaatgcagctattgtagcttgtgaaatggaactgaaatcttctctggttaaaggcaatcaaccaaataccagtggctcttcattctacaacaagaggaccctaacattttctggaggtggaatcaatgttgtatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- SPANX family, member N4 - hypothetical LOC645010 - histone cluster 1, H3c - hypothetical LOC643210

Reviews

Be the first to write your review !

Buy TMEM64-transmembrane protein 64 Gene now