PTXBC107044
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC107044 |
Product type: | DNA & cDNA |
Ncbi symbol: | PATE |
Origin species: | Human |
Product name: | PATE-expressed in prostate and testis Gene |
Size: | 2ug |
Accessions: | BC107044 |
Gene id: | 160065 |
Gene description: | expressed in prostate and testis |
Synonyms: | PATE; prostate and testis expressed protein 1; expressed in prostate and testis; prostate and testis expressed 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggacaagtccctcttgctggaactccccatcctgctctgctgctttagggcattatctggatcactttcaatgagaaatgatgcagtgatagaaattgttcggtgtaggatgtgccacctccagttcccaggagaaaagtgctccagaggaagaggaatatgcacagcaacaacagaagaggcctgcatggttggaaggatgttcaaaagggatggtaatccctggttaaccttcatgggctgcctaaagaactgtgctgatgtgaaaggcataaggtggagtgtctatttggtgaacttcaggtgctgcaggagccatgacctgtgcaatgaagacctttag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - non-protein coding RNA 161 - cytochrome c oxidase subunit 8C - pyroglutamylated RFamide peptide - TBC1 domain family, member 29 |