PTXBC130553
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC130553 |
Product type: | DNA & cDNA |
Ncbi symbol: | C7orf59 |
Origin species: | Human |
Product name: | C7orf59-chromosome 7 open reading frame 59 Gene |
Size: | 2ug |
Accessions: | BC130553 |
Gene id: | 389541 |
Gene description: | chromosome 7 open reading frame 59 |
Synonyms: | UPF0539 protein C7orf59; C7orf59; ragulator complex protein LAMTOR4; late endosomal/lysosomal adaptor and MAPK and MTOR activator 4; late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgacttctgcactgacccaggggctggagcgaatcccagaccagctcggctacctggtactgagtgaaggtgcagtgctggcgtcatctggggacctggagaatgatgagcaggcagccagtgccatctctgagctggtcagcacagcctgcggtttccggctgcaccgcggcatgaatgtgcccttcaagcgcctgtctgtggtctttggagaacacacactgctggtgacggtgtcaggacagagggtgtttgtggtgaagaggcagaaccgaggtcgggagcccattgatgtctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - chromosome 4 open reading frame 12 - chromosome 15 open reading frame 5 - chromosome 2 open reading frame 12 - chromosome 2 open reading frame 82 |