Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PKIG-protein kinase (cAMP-dependent, catalytic) inhibitor gamma Gene
PTXBC104257
New product
Data sheet of PKIG-protein kinase (cAMP-dependent, catalytic) inhibitor gamma Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PKIG-protein kinase (cAMP-dependent, catalytic) inhibitor gamma Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104257 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PKIG |
| Origin species: | Human |
| Product name: | PKIG-protein kinase (cAMP-dependent, catalytic) inhibitor gamma Gene |
| Size: | 2ug |
| Accessions: | BC104257 |
| Gene id: | 11142 |
| Gene description: | protein kinase (cAMP-dependent, catalytic) inhibitor gamma |
| Synonyms: | PKI-gamma; cAMP-dependent protein kinase inhibitor gamma; protein kinase (cAMP-dependent, catalytic) inhibitor gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggaggtcgagtcctcctactcggacttcatctcctgtgaccggacaggccgtcggaatgcggtccctgacatccagggagactcagaggctgtgagcgtgaggaagctggctggagacatgggcgagctggcactcgagggggcagaaggacaggtggagggaagcgccccagacaaggaagctggcaaccagccccagagcagcgatgggaccacctcgtcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycosylphosphatidylinositol anchored molecule like protein - biogenesis of lysosomal organelles complex-1, subunit 1 - CCR4 carbon catabolite repression 4-like (S. cerevisiae) - angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 |