No products
Prices are tax excluded
PTXBC112248
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC112248 |
Product type: | DNA & cDNA |
Ncbi symbol: | ATOX1 |
Origin species: | Human |
Product name: | ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene |
Size: | 2ug |
Accessions: | BC112248 |
Gene id: | 475 |
Gene description: | ATX1 antioxidant protein 1 homolog (yeast) |
Synonyms: | copper transport protein ATOX1; ATX1; HAH1; ATX1 antioxidant protein 1 homolog; metal transport protein ATX1; antioxidant 1 copper chaperone |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgccgaagcacgagttctctgtggacatgacctgtggaggctgtgctgaagctgtctctcgggtcctcaataagcttggaggagttaagtatgacattgacctgcccaacaagaaggtctgcattgaatctgagcacagcatggacactctgcttgcaaccctgaagaaaacaggaaagactgtttcctaccttggccttgagtag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - C-type lectin domain family 12, member A - myosin light chain kinase family, member 4 - zinc finger with KRAB and SCAN domains 1 - CAP-GLY domain containing linker protein 1 |