> >>ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene
ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene View larger

ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene

PTXBC112248

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC112248
Product type: DNA & cDNA
Ncbi symbol: ATOX1
Origin species: Human
Product name: ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene
Size: 2ug
Accessions: BC112248
Gene id: 475
Gene description: ATX1 antioxidant protein 1 homolog (yeast)
Synonyms: copper transport protein ATOX1; ATX1; HAH1; ATX1 antioxidant protein 1 homolog; metal transport protein ATX1; antioxidant 1 copper chaperone
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgaagcacgagttctctgtggacatgacctgtggaggctgtgctgaagctgtctctcgggtcctcaataagcttggaggagttaagtatgacattgacctgcccaacaagaaggtctgcattgaatctgagcacagcatggacactctgcttgcaaccctgaagaaaacaggaaagactgtttcctaccttggccttgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C-type lectin domain family 12, member A
- myosin light chain kinase family, member 4
- zinc finger with KRAB and SCAN domains 1
- CAP-GLY domain containing linker protein 1

Reviews

Buy ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene now

Add to cart