Cart 6 Product Products 692,28 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 € -
No products
To be determined Shipping
692,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 692,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 692,28 €
Data sheet of LOC285679-hypothetical protein LOC285679 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC285679-hypothetical protein LOC285679 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130442 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC285679 |
| Origin species: | Human |
| Product name: | LOC285679-hypothetical protein LOC285679 Gene |
| Size: | 2ug |
| Accessions: | BC130442 |
| Gene id: | 285679 |
| Gene description: | hypothetical protein LOC285679 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgtcatcagtcccgaagacctccgtagagtccttggggtctccatcatccctgagctcctccaagccacgagagcctctgtgtcccctgaagcacccttcacaccagccacctgcgagcaccctatcaccaaacccgaccagctccacagaatccttgggggagaccccacatgcaggcaggtggaggcaggggtcccgctttcctcagcctggatgtgccaacgctgctggacgcataagacaccaaaatcccagacactcccatggacaccgaatatccgacatccacgaacaattgggaatctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 4 open reading frame 6 - T-cell acute lymphocytic leukemia 2 - overexpressed in colon carcinoma-1 - glycophorin C (Gerbich blood group) |