> >>SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene
SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene View larger

SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene

PTXBC109385

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC109385
Product type: DNA & cDNA
Ncbi symbol: SPINK7
Origin species: Human
Product name: SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene
Size: 2ug
Accessions: BC109385
Gene id: 84651
Gene description: serine peptidase inhibitor, Kazal type 7 (putative)
Synonyms: ECG2; serine protease inhibitor Kazal-type 7; ECRG-2; esophagus cancer-related gene 2 protein; esophagus cancer-related gene-2; serine peptidase inhibitor, Kazal type 7 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatcactgggggtctccttctgctctgtacagtggtctatttctgtagcagctcagaagctgctagtctgtctccaaaaaaagtggactgcagcatttacaagaagtatccagtggtggccatcccctgccccatcacatacctaccagtttgtggttctgactacatcacctatgggaatgaatgtcacttgtgtaccgagagcttgaaaagtaatggaagagttcagtttcttcacgatggaagttgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidylprolyl isomerase A (cyclophilin A)-like 4G
- ribosomal RNA processing 7 homolog A (S. cerevisiae)
- chloride channel, calcium activated, family member 4
- mitogen-activated protein kinase binding protein 1

Reviews

Buy SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene now

Add to cart