> >>FLJ26850-FLJ26850 protein Gene
FLJ26850-FLJ26850 protein Gene View larger

FLJ26850-FLJ26850 protein Gene

PTXBC130542

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FLJ26850-FLJ26850 protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ26850-FLJ26850 protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC130542
Product type: DNA & cDNA
Ncbi symbol: FLJ26850
Origin species: Human
Product name: FLJ26850-FLJ26850 protein Gene
Size: 2ug
Accessions: BC130542
Gene id: 400710
Gene description: FLJ26850 protein
Synonyms: FLJ26850 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcactagacagtggggccctcaaggacctggcaaatgggggcttggacctcggatcggcctcccacgcgaagcttgctccccaccagcatccccacgttggtggcgacgctgccccggccccacggatacttccgcgcctgtcagactccctgatgaactacccttcccagagtaccgcgggagctcgggctcctgagggcgacggtcctctgatggcagatgcgggagaaactctggcgtcaggcggccctcgcgtggagcacacgaagtcgtggcttattctggcttcagtatgtggggtggagaaggcgatccacgcagctgcgtctatttcctgtggatcaatcgcaaaatacgttctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lactalbumin, alpha-
- FLJ33360 protein
- FLJ42957 protein
- BTG family, member 2

Reviews

Buy FLJ26850-FLJ26850 protein Gene now

Add to cart