PTXBC105936
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC105936 |
Product type: | DNA & cDNA |
Ncbi symbol: | ZDHHC8P |
Origin species: | Human |
Product name: | ZDHHC8P-zinc finger, DHHC-type containing 8 pseudogene Gene |
Size: | 2ug |
Accessions: | BC105936 |
Gene id: | 150244 |
Gene description: | zinc finger, DHHC-type containing 8 pseudogene |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcatccatccaggagcgcaaggacagggaggagcgtgagtgcctgctgcgctcccaggccgactcactcttcggcgactcaggcgtctatgatgctcccagctcctacagcctgcagcaggccagtgtgctgtctgagggcttccgaggtcctacgctgtgctacagctctacagatgaccttgtggccaggcccggcttcggcggcgcctgcaaccctgtcctgcagacatcattgtcctcgctttccagctccgtgagccgtgcactgcggacgtcgtcctcctccctgcaggctgatcaggtggggaagctgaggcaggaagccctttag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - tumor necrosis factor, alpha-induced protein 2 - cytidine and dCMP deaminase domain containing 1 - fibronectin leucine rich transmembrane protein 2 - fibronectin type III and SPRY domain containing 2 |