Cart 3 Product Products 679,50 € (empty)
-
-
-
1 x ANKMY2-ank...121,50 €
No products
To be determined Shipping
679,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 679,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 679,50 €
Data sheet of GHRH-growth hormone releasing hormone Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GHRH-growth hormone releasing hormone Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC098161 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GHRH |
| Origin species: | Human |
| Product name: | GHRH-growth hormone releasing hormone Gene |
| Size: | 2ug |
| Accessions: | BC098161 |
| Gene id: | 2691 |
| Gene description: | growth hormone releasing hormone |
| Synonyms: | GHRF; GRF; INN; somatoliberin; growth hormone releasing factor; sermorelin; somatocrinin; somatorelin; growth hormone releasing hormone |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccactctgggtgttcttctttgtgatcctcaccctcagcaacagctcccactgctccccacctccccctttgaccctcaggatgcggcggtatgcagatgccatcttcaccaacagctaccggaaggtgctgggccagctgtccgcccgcaagctgctccaggacatcatgagcaggcagcagggagagagcaaccaagagcgaggagcaagggcacggcttggtcgtcaggtagacagcatgtgggcagaacaaaagcaaatggaattggagagcatcctggtggccctgctgcagaagcacaggaactcccagggatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - metallothionein 1D (pseudogene) - expressed in prostate and testis - non-protein coding RNA 161 - cytochrome c oxidase subunit 8C |