Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LOC284297-hypothetical LOC284297 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC284297-hypothetical LOC284297 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130538 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC284297 |
| Origin species: | Human |
| Product name: | LOC284297-hypothetical LOC284297 Gene |
| Size: | 2ug |
| Accessions: | BC130538 |
| Gene id: | 284297 |
| Gene description: | hypothetical LOC284297 |
| Synonyms: | S5D-SRCRB; soluble scavenger receptor cysteine-rich domain-containing protein SSC5D; scavenger receptor cysteine rich domain containing (5 domains); scavenger receptor cysteine rich family, 5 domains; scavenger receptor cysteine-rich glycoprotein; soluble scavenger protein with 5 SRCR domains; soluble scavenger with 5 domains; scavenger receptor cysteine rich family member with 5 domains |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttgtgagccacctgccctggtggagctggtggctgctgtgagggatgtgggtggtcagctgcagagactgacccaggtcgtggaacaggagcggcaggagcgccaagccctgctgctggggctgacgcagctggtagaagctgcccggggtctggggcagctgggtgaggctgtgaagagactggcagagatggcctggaccaccagcatgcctgcaccaaccaccactaccccagaggaagaagaaagacccctgaggggagacgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - yippee-like 2 (Drosophila) - late cornified envelope 3C - late cornified envelope 2D - hypothetical LOC153684 |