Cart 5 Product Products 585,45 € (empty)
-
1 x ANKRD44-an...121,50 € -
1 x MOBP-myeli...113,40 € -
1 x CYTIP-cyto...121,50 € -
1 x C19orf47-c...121,50 € -
No products
To be determined Shipping
585,45 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 585,45 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 585,45 €
View larger 
Data sheet of SPINK6-serine peptidase inhibitor, Kazal type 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPINK6-serine peptidase inhibitor, Kazal type 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032003 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPINK6 |
| Origin species: | Human |
| Product name: | SPINK6-serine peptidase inhibitor, Kazal type 6 Gene |
| Size: | 2ug |
| Accessions: | BC032003 |
| Gene id: | 404203 |
| Gene description: | serine peptidase inhibitor, Kazal type 6 |
| Synonyms: | BUSI2; UNQ844; serine protease inhibitor Kazal-type 6; acrosin inhibitor; kallikrein inhibitor; protease inhibitor H; serine peptidase inhibitor, Kazal type 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaactgtcaggcatgtttctgctcctctctctggctcttttctgctttttaacaggtgtcttcagtcagggaggacaggttgactgtggtgagttccaggacaccaaggtctactgcactcgggaatctaacccacactgtggctctgatggccagacatatggcaataaatgtgccttctgtaaggccatagtgaaaagtggtggaaagattagcctaaagcatcctggaaaatgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serine peptidase inhibitor, Kazal type 4 - F-box and leucine-rich repeat protein 21 - F-box and leucine-rich repeat protein 15 - F-box and leucine-rich repeat protein 17 |