Cart 6 Product Products 1 342,66 € (empty)
-
1 x TMEM69-tra...113,40 € -
1 x ATP1B3-ATP...121,50 € -
1 x ATF1-activ...121,50 € -
1 x ZC3H8-zinc...121,50 € -
-
No products
To be determined Shipping
1 342,66 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 342,66 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 342,66 €
Data sheet of TMEM217-transmembrane protein 217 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM217-transmembrane protein 217 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029657 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM217 |
| Origin species: | Human |
| Product name: | TMEM217-transmembrane protein 217 Gene |
| Size: | 2ug |
| Accessions: | BC029657 |
| Gene id: | 221468 |
| Gene description: | transmembrane protein 217 |
| Synonyms: | C6orf128; dJ355M6.2; transmembrane protein 217 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgtcaggatgttctccctcatggtgggcatcttctctgtccttaataccacccagttcttcatctttgacctgaaccagaagacacacatttgctatgaggccaagttcagcatctacgtggactcaaagtcggagctagtcacttggaccctgttccacagggctaatatcagcactggcctctccctcaccaccatcatcatcggctgcttcctcctttattgtatccacaagaatatctacatggggctgctgatctatgccatgtggatcatcacttacgagctcatcaacttctccatagtcctgctcctcaacgggatcatcaaagatcacttcaagacgctgagttatttgcactggatcttccaaatctcacacatgttcctgcactttttctgtctgcccttcatcgtcaagcatgcatacaacctttacaaggaatcccagactgtgggcaggaaacgccgccacaggctctgctccaccattgcagtgaacttatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G-2 and S-phase expressed 1 - platelet factor 4 variant 1 - transmembrane protein 218 - KCNQ1 downstream neighbor |