Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FLJ42875-hypothetical LOC440556 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ42875-hypothetical LOC440556 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029785 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ42875 |
| Origin species: | Human |
| Product name: | FLJ42875-hypothetical LOC440556 Gene |
| Size: | 2ug |
| Accessions: | BC029785 |
| Gene id: | 440556 |
| Gene description: | hypothetical LOC440556 |
| Synonyms: | long intergenic non-protein coding RNA 982 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaggggcgcggggccggcgccaccccagaggaaaagcccagcggagccgggttgggcaggagctggcggcggcggtgcgctgggccttctgccttggatcctccgcggtcggcaccgcttccctgctcagattcgaacccagattcggctcccaaggctcccacggctccagggtgcccagtcttgcagccagctcgtcgcccgagccccggatggaggaagcgctcactggccgctacctctgctgtttctggcaccagagattgagactgtgaacctgaactcccttgatctcctcccgttgggcccaggagggagccgaatccaggcccaaccgggctcactgagaaggtgcaggaagcccccaacgactcctactcgtgtgcggcccatactgggccaggacgctgcagtggccgagccgctgggtgtctgcaacggggagctcccccgccgctgggggcaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CDC42 small effector 2 - histone cluster 1, H4g - transmembrane protein 64 - SPANX family, member N4 |