Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FEZ1-fasciculation and elongation protein zeta 1 (zygin I) Gene
PTXBC009545
New product
Data sheet of FEZ1-fasciculation and elongation protein zeta 1 (zygin I) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FEZ1-fasciculation and elongation protein zeta 1 (zygin I) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009545 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FEZ1 |
| Origin species: | Human |
| Product name: | FEZ1-fasciculation and elongation protein zeta 1 (zygin I) Gene |
| Size: | 2ug |
| Accessions: | BC009545 |
| Gene id: | 9638 |
| Gene description: | fasciculation and elongation protein zeta 1 (zygin I) |
| Synonyms: | UNC-76; fasciculation and elongation protein zeta-1; zygin I; zygin-1; fasciculation and elongation protein zeta 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggccccactggtgagtctggatgaagagtttgaggaccttcgaccctcctgctcggaggacccggaggagaagccccagtgtttctatggttcatctccccaccatctcgaggacccctccctctccgagcttgagaatttttcttccgaaataatcagcttcaagtccatggaggacctcgtaaatgaatttgatgagaagctcaatgtctgctttcggaactacaacgccaagaccgagaacctagctcccgtgaagaaccagttacagatccaagaggaggaggagacccttcaggacgaggaggtttgggatgctctgacagacaattacatcccttcactctcagaagactggagggatccaaacatcgaggctctgaatggcaactgctctgacactgagatccatgagaaagaagaggaagagttcaatgagaagagtgaaaatgattccggtatcaacgaggagcctctgctcacagcagatcaggtaattgaggagattgaggaaatgatgcagaactccccagaccctgaggaagaagaggaggttctggaagaagaggatggaggagaaacttcctcccaggcagactcggtcctcctgcaggagatgcaggcattgacacagaccttcaacaacaactggtcctatgaagggctgaggcacatgtctgggtctgagctgaccgagctgctggaccaggtggagggtgccatccgtgacttctcggaggagctggtgcagcagctggcccgccgggacgagctggagtttgagaaggaagtgaagaactcctttatcacggtgcttattgaggttcagaacaagcagaaggagcagcgagaactgatgaaaaagaggcggaaagagaaagggctgagcctgcagagcagccggatagagaagggaaaccagatgcctctcaagcgcttcagcatggaaggcatctccaacattctgcagagtggcatccgccagacctttggctcctcaggaactgacaaacagtatctgaacacagtcattccttacgagaagaaagcctctcctccctcagtggaagacctgcagatgctgacaaacattctctttgccatgaaggaggataatgagaaggtgcctactttgctaacggactacattttaaaagtgctctgccctacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fusion (involved in t(12;16) in malignant liposarcoma) - serine peptidase inhibitor, Kazal type 7 (putative) - peptidylprolyl isomerase A (cyclophilin A)-like 4G - ribosomal RNA processing 7 homolog A (S. cerevisiae) |