Cart 3 Product Products 787,55 € (empty)
-
1 x PYCR1-pyrr...113,40 € -
-
No products
To be determined Shipping
787,55 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 787,55 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 787,55 €
View larger 
SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene
PTXBC028088
New product
Data sheet of SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028088 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMEK1 |
| Origin species: | Human |
| Product name: | SMEK1-SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene |
| Size: | 2ug |
| Accessions: | BC028088 |
| Gene id: | 55671 |
| Gene description: | SMEK homolog 1, suppressor of mek1 (Dictyostelium) |
| Synonyms: | SMEK1; FLFL1; KIAA2010; MSTP033; PP4R3; PP4R3A; smk-1; smk1; serine/threonine-protein phosphatase 4 regulatory subunit 3A; SMEK homolog 1, suppressor of mek1; protein phosphatase 4 regulatory subunit 3A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgatgaagatgatgatgaggatgaagataaggaagatacgttaccattgtcaaagaaagcaaaatttgattcataataatggcaacggcctaggatcagtacctgttgaaaaaaactggttctccacccctcccccatacaaaatccacaacaaagcgcagtggtctcttgtgaatgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - agouti signaling protein, nonagouti homolog (mouse) - proteolipid protein 2 (colonic epithelium-enriched) - fibroblast growth factor 9 (glia-activating factor) - LON peptidase N-terminal domain and ring finger 1 |